MATLAB: If vs Switch Case

if statementswitch case

I just started coding earlier this year, and I am trying to figure out when to use certain functions. I currently have a series of 9 if/else statements, and I was wondering if it would be more efficient or if there is a reason to use switch/case over my current if else statements. P is a 9x9x9 3D matrix and C[] is a 3×3 matrix

if true
  % code
if (1<= i && i<=3) && (1<= j && j<=3)
              f = ismember(P(j,k,i),C1);
          elseif (1<= i && i<=3) && (4<= j && j<=6)
              f = ismember(P(j,k,i),C2);
          elseif (1<= i && i<=3) && (7<= j && j<=9)
              f = ismember(P(j,k,i),C3);            
          elseif (4<= i && i<=6) && (1<= j && j<=3)
              f = ismember(P(j,k,i),C4);
          elseif (4<= i && i<=6) && (4<= j && j<=6)
              f = ismember(P(j,k,i),C5);
          elseif (4<= i && i<=6) && (7<= j && j<=9)
              f = ismember(P(j,k,i),C6);
          elseif (7<= i && i<=9) && (1<= j && j<=3)
              f = ismember(P(j,k,i),C7);
          elseif (7<= i && i<=9) && (4<= j && j<=6)
              f = ismember(P(j,k,i),C8);
          else
              f = ismember(P(j,k,i),C9);
          end
          if f == 1
              P(j,k,i) = 0;
end

Best Answer

The only difference between if ... elsif and switch ... case is one of clarity. It shouldn't make much difference in term of performance. switch ... case is less verbose than if ... elseif but can only apply when you're comparing a single variable or expression to a set of possible values.

In your particular, the conditional expression changes all the time so it would be difficult to use a switch.

Related Solutions

MATLAB: Matlab crashes when I paste a long segment of code into an m-file

I can confirm this for R2009a/64/Win7. I've pasted it as multiple lines.

I have opened a new M-file in the editor. Then I've opened the same file using WordPad and inserted the code there. After saving Matlab's editor updated its display and Matlab crashed again. Re-opening Matlab did not crash, but leaves the editor window open. The last semi-colon of the pasted code is marked by M-Lint with the warning:

 An M-Lint problem analyzing this file caused your previous MATLAB session to terminate unexpectedly.

(Very interesting. I'm curious where Matlab stores this information!)

Now I've created an M-Lint report for the file and I got 1440 messages about the usage of "i" and "j" as variables. Finally I've replaced them by "ii" and "jj", copied it and pasted the block to a new file - and Matlab crashed again.

Besides the obvious method to upgrade your Matlab, I suggest to use a less brute way of programming. I boldly claim without a even trying it: This function will be very slow.

MATLAB: Addition of two DNA sequenc

Hi,

There are a couple of minor issues with your implementation that is causing a problem.

Your function is missing an end statement.
Assuming that you wanted to send the ith character of P_DNA1 and P_DNA2 to the function DNA_add, the quotation marks are not needed.
The variable d3 gets overwritten at each iteration of the loop rather than the result of DNA_add being appended to d3.

Here is the modified code which should resolve these issues:

P_DNA1='ACAAGGGTTTAAACCCTTAC';
P_DNA2='TTTTGGGAAATGTGACATAT';
[m n]=size(P_DNA1);
mn=m*n;
d3=[];
for i = 1:mn
      d3 = [d3 DNA_add(P_DNA1(i),P_DNA2(i))];
end
function K = DNA_add(Q1,Q2)
if Q1=='A' && Q2=='A';
    K = 'A';
elseif Q1=='A' && Q2=='G';
    K = 'G';
elseif Q1=='A' && Q2=='C';
    K = 'C';
elseif Q1=='A' && Q2=='T';
    K = 'T';
elseif Q1=='G' && Q2=='A';
    K = 'G';
elseif Q1=='G' && Q2=='G';
    K = 'C';
elseif Q1=='G' && Q2=='C';
    K = 'T';
elseif Q1=='G' && Q2=='T';
    K = 'A';
elseif Q1=='C' && Q2=='A';
    K = 'C';
elseif Q1=='C' && Q2=='G';
    K = 'T';
elseif Q1=='C' && Q2=='C';
    K = 'A';
elseif Q1=='C' && Q2=='T';
    K = 'G';
elseif Q1=='T' && Q2=='A';
    K = 'T';
elseif Q1=='T' && Q2=='G';
    K = 'A';
elseif Q1=='T' && Q2=='C';
    K = 'G';
elseif Q1=='T' && Q2=='T';
    K = 'C';
end
end

Best Answer

Related Solutions

MATLAB: Matlab crashes when I paste a long segment of code into an m-file

MATLAB: Addition of two DNA sequenc

Related Question