MATLAB: How to store Values in a Loop

how to save the loop data to an excel file in a multilooped program ?stephen trainor 0 flag running through a loop and storing values

for t=0:1:10
    L(t) = 3*cos(t);
    M(t) = diag([L 5*cos(t) 7*cos(t)]);
    K(t) = [12e5*cos(t) 18e5*cos(t) 34e5*cos(t);18e5*cos(t) 15e5*cos(t) 12e5*cos(t);13e5*cos(t) 12e5*cos(t) 22e5*cos(t)];
    [X,e] = polyeig(K, M)
    o = sqrt(e);
    fprintf('the freqeuncy is"%d" \n',o)
    writematrix(o,'hello/tt.xlsx','sheet',1,'range','A1:A30');
end

Hi, From the above code I am trying to store 10 time series in a single excel file but I can't able to do it and getting a error like "Array indices must be positive integers or logical values". Can anyone please help me in this.

Thank you in Advance.

Best Answer

for t=0:10
    L = 3*cos(t);
    M = diag([L 5*cos(t) 7*cos(t)]);
    K = [12e5*cos(t) 18e5*cos(t) 34e5*cos(t);18e5*cos(t) 15e5*cos(t) 12e5*cos(t);13e5*cos(t) 12e5*cos(t) 22e5*cos(t)];
    [X,e] = polyeig(K, M)%X is a 3x3 matrix, e is 3x1 vector
    o(:,t+1) = sqrt(e);%o is a 3x11 matrix when the loop finishes
end
writematrix(o,'hello/tt.xlsx','sheet',1,'range','A1:A30');

The only thing you are writing to file is the variable o; therefore it is the only thing needing to be in an array.

Related Solutions

MATLAB: Addition of two DNA sequenc

Hi,

There are a couple of minor issues with your implementation that is causing a problem.

Your function is missing an end statement.
Assuming that you wanted to send the ith character of P_DNA1 and P_DNA2 to the function DNA_add, the quotation marks are not needed.
The variable d3 gets overwritten at each iteration of the loop rather than the result of DNA_add being appended to d3.

Here is the modified code which should resolve these issues:

P_DNA1='ACAAGGGTTTAAACCCTTAC';
P_DNA2='TTTTGGGAAATGTGACATAT';
[m n]=size(P_DNA1);
mn=m*n;
d3=[];
for i = 1:mn
      d3 = [d3 DNA_add(P_DNA1(i),P_DNA2(i))];
end
function K = DNA_add(Q1,Q2)
if Q1=='A' && Q2=='A';
    K = 'A';
elseif Q1=='A' && Q2=='G';
    K = 'G';
elseif Q1=='A' && Q2=='C';
    K = 'C';
elseif Q1=='A' && Q2=='T';
    K = 'T';
elseif Q1=='G' && Q2=='A';
    K = 'G';
elseif Q1=='G' && Q2=='G';
    K = 'C';
elseif Q1=='G' && Q2=='C';
    K = 'T';
elseif Q1=='G' && Q2=='T';
    K = 'A';
elseif Q1=='C' && Q2=='A';
    K = 'C';
elseif Q1=='C' && Q2=='G';
    K = 'T';
elseif Q1=='C' && Q2=='C';
    K = 'A';
elseif Q1=='C' && Q2=='T';
    K = 'G';
elseif Q1=='T' && Q2=='A';
    K = 'T';
elseif Q1=='T' && Q2=='G';
    K = 'A';
elseif Q1=='T' && Q2=='C';
    K = 'G';
elseif Q1=='T' && Q2=='T';
    K = 'C';
end
end

MATLAB: Loading variables & using ‘for’ loop for comman polyeig()

It is not a good idea to name variable like K1, K2, K3, ... It makes code complicated: https://www.mathworks.com/matlabcentral/answers/304528-tutorial-why-variables-should-not-be-named-dynamically-eval. First I will convert K1, K2, ..., Kn to cell array and then return the output in cell arrays.

K = {K1, K2, K3, .., K10}; % list all the Kxx variables here
M; % matrix
[X, E] = cellfun(@(k) polyeig(k, M), K, 'uni', 0);

Access the results like this

X{1}; % first element of X
X{2}; % second element of X
..
X{end}; % last element of X
E{1}; % first element of E
E{2}; % second element of E
..
E{end}; % last element of E

Best Answer

Related Solutions

MATLAB: Addition of two DNA sequenc

MATLAB: Loading variables & using ‘for’ loop for comman polyeig()

Related Question