MATLAB: Encoding Binary to DNA sequencing

binarydna sequencingfor loop

I am trying to convert the string into binary and sequencing with DNA,but i am getting error as follows :

Attempted to access bases(145); index out of bounds because numel(bases)=4.
Error in ==> filename at 21
result((k+1)/2) = bases(index);

What is the solution for this? Here is the code:

clc;
ui=input('enter the message:','s')
decString = unicode2native(ui,'utf-8')
hexString = dec2hex(decString)
binaryArray= dec2bin(decString,8)
bases = 'ATGC';
for k = 1 : 2 : length(binaryArray)
    % Convert these two digits into a number 1 - 4.
    index = 2 * binaryArray(k) + binaryArray(k+1) + 1;
    % Use that index to assign a letter to our result.
    result((k+1)/2) = bases(index);
end
% Display in command window:
result

Thank you

Best Answer

bases has only 4 elements so index must stay in the range 1,2,3,4 not 145 like you have it. Think about the logic some more.

Related Solutions

MATLAB: Binary to DNA sequence encoding – matlab

Perhaps this:

% Assign sample data.
binaryArray = [0,1,1,0,0,0,1,1, 0,1,1,1,0,0,1,0, 0,1,1,1,1,0,0,1, 0,1,1,1,0,0,0,0, 0,1,1,1,0,1,0,0, 0,1,1,0,1,1,1,1];
% Define base letters to choose from.
bases = 'ATGC';
for k = 1 : 2 : length(binaryArray)
  % Convert these two digits into a number 1 - 4.
  index = 2 * binaryArray(k) + binaryArray(k+1) + 1;
  % Use that index to assign a letter to our result.
  result((k+1)/2) = bases(index);
end
% Display in command window:
result

It shows:

result =
TGACTCAGTCGTTCAATCTATGCC

MATLAB: Function Error / If and elseif statement help

As a replacement for what you have done here, I would suggest using ismember to find the triples that form valid codes. You can even use it to keep track of every marked position so you can see if you forgot to implement any triples.

amino_acid_chain = cellstr(reshape(neucleotide_string,3,[])');
L=false(size(amino_acid_chain));%keep track of replaced codes
library={{'E','GAA','GAG'};...
    {'W','UGG'}};%etc
for n=1:numel(library)
    triplet=library{n}(2:end);%select the triplet(s) from the library (e.g. {'GAA','GAG'})
    letter=library{n}(1);%select the corresponding amino acid letter (e.g. 'E')
    L_current_code=ismember(amino_acid_chain,triplet);%find all positions where the amino acid occurs
    amino_acid_chain(L_current_code)=letter;%replace by the letter code
    L=L | L_current_code;%mark as replaced
end
if any(~L)%shouldn't happen
    error('some code was not implemented correctly')
end

Best Answer

Related Solutions

MATLAB: Binary to DNA sequence encoding – matlab

MATLAB: Function Error / If and elseif statement help

Related Question