MATLAB: Decoding DNA sequence into binary

binarydna sequencingMATLAB

I have a sequence TGACTCAGTCGTTCAATCTATGCC, how to write code in matlab to convert it into binary? Please help me..Thank you

Best Answer

One way:

s = 'TGACTCAGTCGTTCAATCTATGCC';  % Input DNA string
[~,x] = ismember(s,'ATGC');  % Convert the ATGC into indexes
c = {'00','01','10','11'};  % Numeric strings to convert the indexes into
result = cell2mat(c(x));  % Convert the indexes into the numeric strings

Related Solutions

MATLAB: How to perform bitwise XOR operation and scramble two matrices

I would precompute two lookup tables (arrays) to perform the conversion from letters to numbers and back:

l2n('AGCT') = [0 1 2 3];
n2l= 'AGCT';

You only need to calculate l2n and n2l once and you can then convert from a letter sequence to numbers with:

s = 'GATT';
n = l2n(s); %gives n = [1 0 3 3].

And back:

sb = n2l(n+1); % +1 as matlab indices start at 1. gives sb='GATT'.

Calculating the xor of two sequences is then:

a = 'GATT';
b = 'ATAC';
c= n2l(bitxor(l2n(a), l2n(b)) + 1)
 c = 
    'GTTG'

and for two cell arrays of the same size:

A =  {    'GATT'    'AACT'    'ACAC'    'TTGA'    'GGCT'    
          'GCAC'    'TCAT'    'GTTC'    'GCCT'    'TTTA'    
          'AACG'    'GTTA'    'ACGT'    'CGTC'    'TGGA'    
          'CTAC'    'AAAA'    'GGGC'    'CCCT'    'TCGT'    
          'GTGT'    'GCGG'    'GTTT'    'TTGC'    'ATTA'};
B =  {    'ATAC'    'AAAT'    'AGCT'    'AAGC'    'AAGT'    
          'TAGG'    'AAGT'    'ATGA'    'AAAG'    'AAGA'    
          'TAGC'    'CAGT'    'AGAT'    'GAAG'    'TCGA' 
          'GCTA'    'TTAC'    'GCCA'    'CCCC'    'TTTC'
          'CCAA'    'AGGA'    'GCAG'    'CAGC'    'TAAA'};
C = cellfun(@(sa, sb) n2l(bitxor(l2n(sa), l2n(sb)) + 1), A, B, 'UniformOutput', false)
C = 
    'GTTG'    'AACA'    'ATCG'    'TTAC'    'GGTA'
    'CCGT'    'TCGA'    'GACC'    'GCCC'    'TTCA'
    'TATT'    'TTCT'    'ATGA'    'TGTT'    'ATAA'
    'TGTC'    'TTAC'    'ATTC'    'AAAG'    'AGCG'
    'TGGT'    'GTAG'    'AGTC'    'GTAA'    'TTTA'

edited for spelling

MATLAB: I want to make a full string from all the “a” values that i get

I am not completly sure I understood your question but you could do something like this:

reversedDNA = 'TACATGA'
function complementedDNA = r_dnasepinaka(reversedDNA)
    complementedDNA = reversedDNA;
    complementedDNA(reversedDNA == 'T') = 'A';
    complementedDNA(reversedDNA == 'A') = 'T';
    complementedDNA(reversedDNA == 'C') = 'G';
    complementedDNA(reversedDNA == 'G') = 'C';
end

and something like this to get all the As:

function [UniqueCharStr , PositionList] = getSingleChar(DNA , Char)
    PositionList = find( DNA == Char );
    UniqueCharStr = DNA( PositionList );
end
getSingleChar(reversedDNA , 'A')

Best Answer

Related Solutions

MATLAB: How to perform bitwise XOR operation and scramble two matrices

MATLAB: I want to make a full string from all the “a” values that i get

Related Question